Applied Biological Materials (abm)

CRISPR Scrambled sgRNA Lentivirus (for spCas9)

Product Code:
ABM-K019
Regulatory Status:
RUO
Shipping:
Dry Ice
Storage:
-80°C
 

No additional charges, what you see is what you pay! *

Stay in control of your spending. These prices have no additional charges to UK mainland customers, not even shipping!
* Rare exceptions are clearly labelled (only 0.14% of items!).
Multibuy discounts available! Contact us to find what you can save.
This product comes from: Canada.
Typical lead time: 10-14 working days.
Contact us for more accurate information.
  • Further Information
  • Show All

Further Information

Description:
Control CRISPR Lentivirus with scrambled sgRNA for spCas9. scrambled sequence:GCACTCACATCGCTACATCA